J Korean Ophthalmol Soc > Volume 65(5); 2024 > Article
콜레토트리쿰 자스미니젠에 의한 감염각공막염

국문초록

목적

Colletotrichum jasminigenum이 동정된 감염각공막염 환자를 치험하였기에 보고하고자 한다.

증례요약

81세 남자가 내원 7일 전 시작된 좌안 통증 및 시력저하를 주소로 내원하였다. 환자는 10년 전 좌안 익상편 절제술을 시행하였다. 내원 당시 코쪽 결막결손 및 공막용해, 인접 각막의 깃털모양 심부 각막기질침윤 및 전방축농이 관찰되었다. 진균에 의한 감염각공막염 진단하 potassium hydroxide (KOH)와 도말검사 그리고 배양검사를 시행하였다. KOH 검사 결과 균사가 관찰되어 전신 플루코나졸 투여 및 플루코나졸, 나타마이신 점안액으로 치료를 시작하였다. 하지만 각막침윤 및 공막용해가 진행되어 공막괴사 부위 제거 및 공막이식, 자가 결막이식, 전방세척술, 전방 및 유리체강 내 보리코나졸 주입술을 시행하였고 항진균제를 보리코나졸로 변경하여 치료를 지속하였다. 배양검사에서 진균이 검출되었으며 추가적으로 DNA 염기서열분석 시행 후 Colletotrichum jasminigenum이 동정되었다. 치료 후 병변은 호전되었으며 현재까지 재발 없이 유지되고 있다.

결론

Colletotrichum jasminigenum에 의한 감염각공막염 환자에서 보리코나졸이 효과적인 치료가 될 수 있다.

ABSTRACT

Purpose

We present a case of Colletotrichum jasminigenum (C. jasminigenum)-induced Infectious sclerokeratitis.

Case summary

An 81-year-old patient presented to our hospital with left eye pain and decreased vision that had started 7 days prior. He had a history of left eye pterygium excision a decade earlier. Examination using a slit lamp revealed a nasal conjunctival defect, scleral melting, deep stromal infiltration with a feathery margin, and hypopyon. Considering the suspicion of fungal sclerokeratitis, we performed a smear analysis and potassium hydroxide (KOH) and culture testing. The KOH test revealed hyphae, leading to systemic fluconazole and topical fluconazole and natamycin. Subsequently, we performed surgery, including debridement of the necrotic scleral area, conjunctival rotation and scleral grafting, and anterior chamber irrigation with intracameral and intravitreal voriconazole injections, due to progressive corneal infiltration and scleral melting. Additionally, we switched to using systemic and topical voriconazole. The culture yielded fungi, with DNA sequencing confirming C. jasminigenum as the causative agent. Following treatment, the lesion improved, and no signs of recurrence were observed.

Conclusions

Voriconazole is an effective treatment for C. jasminigenum-induced fungal sclerokeratitis.

공막염은 공막을 침범하여 통증, 충혈 등의 증상을 일으키는 염증성 질환이며 공막혈관의 확장과 공막부종 그리고 심하면 공막괴사를 관찰할 수 있다.1,2 공막염은 원인에 따라 감염성(infectious)과 비감염성(non-infectious)으로 분류할 수 있다. 감염성은 4-18% 정도로 드물지만 심한 경우 인접한 각막의 침범으로 인한 각공막염 및 안내염까지 진행되어 시력 예후가 극히 나쁠 수 있다. 뿐만 아니라 임상 양상만으로는 비감염성 괴사성 공막염과의 감별이 힘들고 원인균이 되는 병원체를 동정하여 적절한 약제를 충분한 기간 동안 사용하는 것이 중요한 질환이다.
감염공막염을 유발할 수 있는 선행 요인은 안외상, 수술, 혈행성 균 전파, 면역저하, 약물 오남용 등이 있으며, 특히 익상편 수술 후 감염공막염이 자주 발생하여 보고되고 있다.3 병원체는 세균, 바이러스, 진균, 기생충 등이 가능하며 세균은 Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus pneumonia, 바이러스에는 herpes simplex virus, herpes zoster, 진균은 Aspergillus, Nocardia, Candida, 기생충은 Toxoplasma gondii 등이 동정되는 것으로 보고된다.4
전 세계적으로 Colletotrichum genus에 의한 감염각공막염 증례가 드물게 보고되지만 현재까지 국내에서는 진균인 Colletotrichum jasminigenum이 동정된 감염각공막염 환자는 없었으며, 저자들은 성공적으로 해당 환자를 치료하였기에 보고하고자 한다.

증례보고

81세 남자가 내원 7일 전부터 시작된 좌안 통증 및 시력 저하를 주소로 내원하였다. 좌안에 화농성의 분비물이 동반되었으며, 약 10년 전 익상편 절제술의 과거력이 있었다. 내원 당시 교정시력은 우안 20/20, 좌안 20/125였고, 안압은 우안 14 mmHg, 좌안 17 mmHg였다. 내원 당시 세극등 검사상 코쪽 결막결손 및 공막용해 소견과 인접한 각막에 깃털모양 경계를 가진 심부 각막기질침윤 그리고 전방축농을 동반한 심한 전방 내 염증이 관찰되었다(Fig. 1A, B). 익상편 수술 부위의 공막염에서 시작된 진균에 의한 감염각공막염 의심 하에 병변 부위를 찰과하여 potassium hydroxide (KOH) 검사를 시행하였다. 현미경에서 균사가 관찰되었으며(Fig. 1C), 초음파검사에서는 유리체혼탁이 관찰되었다(Fig. 1D). 입원 후 공막괴사 부위 제거, 전방세척술, 전방 및 유리체강 내 보리코나졸 주입술, 도말 및 배양검사를 시행하였다. 전방 및 유리체강 내 보리코나졸 주입술을 위한 농도는 50 μg/0.1 mL였으며 평형염류용액(balanced salt solution [BSS], Alcon, Fort Worth, TX, USA)으로 희석하여 제작하였다. 전신적으로는 플루코나졸(Oneflu®, JW Pharm Co., Gwacheon, Korea)을 투여하였으며 점안액은 목시플록사신(Moroxacin®, Hanmi Pharm Co., Seoul, Korea), 증류수에 희석하여 제조한 0.2% 플루코나졸 제조 안약(Oneflu®, JW Pharm Co.), 나타마이신(Natacyn®, Alcon, Geneve, Switzerland)을 좌안에 1시간 간격으로 점안하였다.
전신 항진균제 및 점안액을 투여하였음에도 불구하고 입원 3일차에 공막 용해 및 포도막 노출, 인접 각막의 깃털모양 경계 심부 각막기질침윤 진행, 전방축농 등에서 호전이 없어(Fig. 2A), 공막괴사 부위 제거 및 공막이식, 자가 결막 이식을 추가적으로 시행하였다(Fig. 2B). 전신 항진균제를 플루코나졸에서 보리코나졸(Vfend®, Pfizer inc., New York, NY, USA)로 변경하였고 점안액 또한 증류수에 희석한 1% 보리코나졸 제조 안약(VFEND®, Pfizer inc.)으로 변경하여 좌안에 1시간 간격으로 점안하였다. 수술과 전신 항진균제 및 점안액 변경 후 입원 7일차 병변의 호전이 관찰되었다.
입원 8일차 배양검사 결과 동정되지 않은 사상균(unidentified mold)이 관찰되어 정확한 감별을 위해 DNA의 internal transcribed spacer (ITS) 및 larger ribosomal subunit's D1/D2 region의 염기서열분석을 시행하였다. 분석 방법은 ITS5_F (GGAAGTAAAAGTCGTAACAAGG)와 ITS4_R (TCCTCCGCTTATTGATA TGC) 시발체(primer)를 이용하여 얻은 염기서열을 national center for biotechnology information의 basic local alignment search data base로 분석하여 동일성이 가장 높은 균주로 하였다.
전신 보리코나졸 투여 및 보리코나졸, 나타마이신 점안액을 유지하였고 입원 16일차 DNA ITS 및 염기서열분석 결과 Colletotrichum jasminigenim이 동정되었다(Fig. 3). 추가적으로 감염이 조절되고 병변이 호전되어 전신에서 경구보리코나졸로 변경, 보리코나졸, 나타마이신 점안액을 유지하면서 퇴원하였다.
퇴원 후 병변이 호전을 보임에 따라 약물 점안 간격을 점차 늘리고 퇴원 후 15주 이후부터 목시플록사신만 하루 4번 점안하였고, 28주 이후에는 인공누액을 제외한 다른 점안액은 중단하였다. 7개월 후 좌안 시력은 20/100, 안압 15 mmHg/GAT로 경과 관찰까지 병변은 재발 없이 유지되고 있다(Fig. 4).

고 찰

공막염의 경우 전체 환자의 약 90%는 자가면역 질환의 비감염성 기전으로 발생하지만 나머지 약 10%의 경우에는 감염으로 인해 발생한다. 감염공막염은 외인성 및 내인성으로 나뉘며 원인으로 안외상, 혈행성 전파, 수술, 면역저하, 약물 오남용, 안구염증 질환 등 매우 다양하며 세균, 바이러스, 진균, 기생충 모두가 병원체가 될 수 있다. 특히 익상편 제거술, 녹내장 등과 같은 수술 후 발생하는 감염공막염의 경우 수술 후 수개월 길게는 수십년 후에도 발생할 수 있다고 보고되고 있다.5 감염공막염의 경우 시력 예후가 좋지 않으며 심한 경우 안구적출술까지 시행해야 할 정도로 치료가 힘든 질환이다.6
그중 진균에 의한 공막염은 외상 및 수술과 많은 관련이 있으며 AspergillusNocardia가 가장 흔하다고 보고된다.7,8 본 증례의 경우 전신 질환으로 당뇨가 있었고 최근 농사일 도중 눈을 자주 비빈 과거력이 있어 외상이 있었을 가능성 그리고 익상편 수술 시 bare sclera technique 시행 및 이로 인한 scleromalacia 소견 등이 감염각공막염의 선행 요인이 되었을 수 있다.
진균감염은 세균 및 바이러스감염에 비해 증상이 심하고 공격적이며 진단하는 데 오랜 시간이 소요된다. 또한 항진균제는 괴사된 공막이나 무혈관의 공막에 침투가 잘 되지않고, 진균이 공막에 잠복하여 남아있을 수 있어 세균 및 바이러스와 비교하였을 때 예후가 좋지 않은 것으로 알려져 있으며, 각공막염, 안내염 등과 같은 합병증이 발생하고 안구를 제거해야 하는 경우가 약 50% 정도에 이른다.7,8
따라서, 진균공막염은 전신 항진균제 투여 및 안약을 초기에 집중적으로 사용하고 임상 증상이 호전되더라도 진균이 오랜 기간 동안 공막에 잠복하여 남아있을 수 있는 점을 고려하여 충분한 기간 동안 약물을 사용해야 한다. 약물로 조절이 안되거나 병변이 진행할 경우 수술적 치료가 필요하다. 해외 연구 결과에서 감염 조기에 공막괴사 부위를 제거해주는 것이 익상편 수술 후에 발생한 감염공막염의 치료에 도움이 된다는 보고도 있다.9 감염공막염의 수술적 치료에는 공막괴사 부위 제거 및 동종공막이식술, 자가결막이식술, 측두근막이식술, 자가대퇴근막 이식술 등이 있고7 저자들은 이전 연구에서 자가 귀구슬 연골막 이식술을 통해 성공적인 공막 재건 및 감염 치료를 한 증례도 보고하였다.10
본 증례에서도 전신 항진균제 투여 및 안약 점안 후에도 병변이 호전되지 않았고, 임상 양상 등에서 진균각공막염을 의심하여 입원 3일차에 조기 수술적 치료를 시행하고 항진균제도 변경하였다. 이렇게 괴사된 공막을 제거하여 침투가 어려운 항진균제의 투과성을 높여주고 보리코나졸 등 감수성이 있는 약제로 변경한 점이 성공적인 치료를 할 수 있었던 요인으로 생각이 된다.
본 증례의 Colletotrichum genus의 진균들은 주로 식물에 중요한 병원체로 비싼 농작물에 질병을 일으켜 많은 농업적 피해를 일으킨다. 인체에 대한 감염은 드물지만 fungal keratitis에서 약 3.3%의 비율로 원인균을 보고되고 있다. 경미한 임상 증상에서부터 안구제거를 해야 할 정도로 치명적인 감염이 보고되고 있다.11,12 외국에서는 암포테리신B, 나타마이신, 플루코나졸, 보리코나졸 등을 이용하여 성공적으로 치료를 하였으나 현재 효과적인 치료법에 대한 합의는 없는 상황이다.
익상편 수술력이 있는 환자에서 감염성 공막염이 발생하였을 때 진균에 의한 것임을 빨리 인식하고 정확한 병원체의 동정을 위해 배양, 조직검사 등의 검사가 필요하다. 진균공막염은 앞서 언급하였듯이 각공막염, 안내염 등의 심한 합병증을 유발하고, 안구를 제거할 가능성이 높은 만큼 조기에 수술적 치료를 고려하고, 감수성이 있는 항진균제를 임상 증상이 호전되더라도 장기적으로 사용하는 것이 안구를 보존하는 데 중요할 것으로 생각된다.
결론적으로 국내 처음으로 Colletotrichum jasminigenim에 의한 각공막염 환자에서 보리코나졸 안약을 사용하여 성공적으로 치료하였고 안구 보존 및 재발 없이 경과 관찰 중이며, 이 보고가 앞으로 Colletotrichum jasminigenum 감염 환자의 치료에 있어 도움이 될 것으로 생각된다.

Acknowledgments

This work was supported by biomedical research institute fund [GNUHBRIF-2023-0002] from the Gyeongsang National University Hospital and the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT), grant number No. [NRF2023R1A2C1007712 and 2021R1A4A3027122].

NOTES

Conflicts of Interest

The authors have no conflicts to disclose.

Figure 1.
Initial findings of ocular examinations. The initial anterior segment examinations showed conjunctival defect, underlying scleral melting on the nasal side, deep stromal infiltration with feathery margin in the adjacent cornea (A), and indicated hypopyon in the anterior chamber (B). (C) Hyphae was detected on the potassium hydroxide (KOH) smear (×200). (D) B-scan revealed the presence of vitreous opacity.
jkos-2024-65-5-337f1.jpg
Figure 2.
Anterior segment photographs of the lesion before and after surgery. (A) Corneal infiltration and scleral melting aggravated at the 3rd day of hospitalization. (B) Surgery was performed, including debridement of the scleral necrotic area, scleral grafting, conjunctival rotation grafting, anterior chamber irrigation, and intracameral and intravitreal voriconazole injections.
jkos-2024-65-5-337f2.jpg
Figure 3.
DNA internal transcribed spacer (ITS) and DNA sequencing of larger ribosomal subunit's D1/D2 region.
jkos-2024-65-5-337f3.jpg
Figure 4.
Anterior segment photographs during the follow up period. (A) 3 weeks after discharge from hospitalization. (B) 7 weeks after discharge. (C) 11 weeks after discharge. (D) 28 weeks after discharge. The lesion improved after treatment and has remained stable without recurrence.
jkos-2024-65-5-337f4.jpg

REFERENCES

1) Sims J. Scleritis: presentations, disease associations and management. Postgrad Med J 2012;88:713-8.
crossref pmid pdf
2) de Fidelix TS, Vieira LA, de Freitas D, Trevisani VF. Biologic therapy for refractory scleritis: a new treatment perspective. Int Ophthalmol 2015;35:903-12.
crossref pmid pdf
3) Murthy SI, Sabhapandit S, Balamurugan S, et al. Scleritis: differentiating infectious from non-infectious entities. Indian J Ophthalmol 2020;68:1818-28.
crossref pmid pmc
4) Moshirfar M, Ronquillo Y. Infectious Scleritis. Treasure Island (FL): StatPearls Publishing, 2022.
5) Hodson KL, Galor A, Karp CL, et al. Epidemiology and visual outcomes in patients with infectious scleritis. Cornea 2013;32:466-72.
crossref pmid
6) Ho YF, Yeh LK, Tan HY, et al. Infectious scleritis in Taiwan-a 10-year review in a tertiary-care hospital. Cornea 2014;33:838-43.
crossref pmid
7) Ramenaden ER, Raiji VR. Clinical characteristics and visual outcomes in infectious scleritis: a review. Clin Ophthalmol 2013;7:2113-22.
pmid pmc
8) Jain V, Garg P, Sharma S. Microbial scleritis-experience from a developing country. Eye (Lond) 2009;23:255-61.
crossref pmid pdf
9) Tittler EH, Nguyen P, Rue KS, et al. Early surgical debridement in the management of infectious scleritis after pterygium excision. J Ophthalmic Inflamm Infect 2012;2:81-7.
crossref pmid pmc pdf
10) Yoo WS, Kim CR, Kim BJ, et al. Successful treatment of infectious scleritis by Pseudomonas aeruginosa with autologous perichondrium graft of conchal cartilage. Yonsei Med J 2015;56:1738-41.
crossref pmid pmc
11) Hung N, Hsiao CH, Yang CS, et al. Colletotrichum keratitis: a rare yet important fungal infection of human eyes. Mycoses 2020;63:407-15.
crossref pmid pdf
12) Fernandez V, Dursun D, Miller D, Alfonso EC. Colletotrichum keratitis. Am J Ophthalmol 2002;134:435-8.
crossref pmid

Biography

정인석 / In Seok Jeong
Department of Ophthalmology, Gyeongsang National University Hospital, Gyeongsang National University College of Medicine
TOOLS
METRICS Graph View
  • 0 Crossref
  •  0 Scopus
  • 296 View
  • 28 Download
Related articles


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
SKY 1004 Building #701
50-1 Jungnim-ro, Jung-gu, Seoul 04508, Korea
Tel: +82-2-583-6520    Fax: +82-2-583-6521    E-mail: kos08@ophthalmology.org                

Copyright © 2024 by Korean Ophthalmological Society.

Developed in M2PI

Close layer
prev next